iGEM Biotech EC | EC Bab

1.1 Project Summary

Among the livestock diseases of greatest relevance and incidence in Latin American countries are those caused by hemoparasites [1]. These diseases are transmitted by vectors such as hematophagous ticks and flies. Within this group of diseases we find Anaplasmosis, Trypanosomiasis and bovine Babesiosis, which negatively affect livestock production, increasing the morbidity and mortality rates of cattle, causing substantial losses to producers and becoming an animal health problem [2].

According to Peter [3], it is estimated that livestock form a component of 70% of the livelihood of the world's poor. In Ecuador, being a developing country with scarce resources, parasitism becomes a major problem due to lack of knowledge, money and indiscriminate use of drugs. Early diagnosis and research of potential molecular markers of hemotropic parasites play an important role in providing timely intervention and control of the disease. Currently, there are detection methods based on visual identification of the organism, identification of cellular components, metabolic products, detection of antigenic components or nucleic acid-based techniques, the latter offering the highest sensitivity and specificity. However, these methods have certain disadvantages such as false positives or false negatives, high cost of reagents, as well as the need for equipment that is difficult to access in rural areas [4]. 

That is why iGEM Biotech EC is working on the development of a rapid detection test for bovine Babesiosis, in order to prevent the spread of the disease in cattle and thus reduce its economic repercussions for livestock families. While hemotropic diseases are known to affect animals living in tropical and subtropical areas, outbreaks of bovine Babesiosis have recently been reported in cold climates [5]. This fact puts at risk the economy of both the Ecuadorian coast and highlands, which has the largest dairy production nationwide [6].Therefore, we have joined efforts focused on the detection of Babesia bovis, the hemoparasite that causes this disease, considering the testimonies of Ecuadorian cattle breeders, based on the principles of knowing, listening and understanding, which has allowed us to determine their real needs and apply them in the design of our project. 

The design of our screening test is based on toehold switch technology in a Cell-Free system. Toehold switch consists of a synthetic RNA capable of forming a secondary structure, it has a binding domain which is complementary to the sequence to be detected (trigger), a hairpin sequence containing the ribosome binding site (RBS), followed by the reporter gene sequence bound by a linker, which will be expressed only in the presence of the trigger [7].

In addition, to increase the specificity of the system, two types of circuits have been established that function as AND logic gates, thus the system is activated only in the presence of two pathogen-specific triggers. The objective is to design the two types of constructs with an AND logic gate and by modeling decide the most optimal system. The first circuit consists of a single double hairpin toehold capable of recognizing two different RNA sequences (biomarkers), both belonging to the Babesia bovis genome. These biomarkers correspond to the trigger sequences, which upon selective and sequential binding to the corresponding domain of the toehold switch, allow the release of RBS leading to the production of the LacZ reporter protein. The second circuit is constituted by two separate toehold switches that recognize two trigger sequences individually, which allows the production of the HprR and HprS proteins that form a complex that activates the inducible HprL promoter, thus allowing the expression of the LacZ reporter protein. 

Finally, we as a team hope to continue with the next phases of our project based on synthetic biology, since the future perspective is to commercialize the rapid detection test, thus implementing a new alternative for the diagnosis of bovine Babesiosis in field. 

Figure 1. Project Graphical Abstract.

References

1.2 Promotional Video

Source: iGEM Biotech EC Youtube Channel

1.3 Project Presentation Video

In progress...

1.4 Education and Communication Infographic

Infographic: Rapid Diagnostic Test for Babesia bovis

1.5 Team and Attributions

Figure 1. Team Members: Students, Instructors and Mentors. 

Students

• María Belén Alulema: Team co-leader, has contributed in the management of programs and analysis of results in the Dry Lab - Design and Modeling group. 
• Evelyn Pulles: Team co-leader, member of the Dry Lab - Design and Modelling group on the toehold switch design and mathematical modeling of reactions. Support in the safety group and presentations in the education group. 
• Paúl Marquez: Team co-leader, has organized the general activities of the team. 
• Milenka Vera: Coordinator of Dry Lab - Design group, has contributed in the execution of the toehold switch design and member of the modeling and education group. 
• Estefanía Jinez: Coordinator of the Dry Lab - Design group, she has been in charge of the organization and construction of the biological design, besides being a member of the modeling group helping in the construction of the kinetic models and coordinator of the Education committee.
• Marco Córdova: Coordinator of the Dry Lab - Modeling group, member of the Human Practices and Education committee. He contributed to the development of the MATLAB script, to the approach and correction of the models.
• Wendy Tiscama: Human Practices Coordinator, organized the activities to be carried out during the competition, proposed new ideas, contributed with the design and economic analysis of iGEM Biotech EC business model as a start-up and member of the education committee.
• María del Carmen Mendoza: Human Practices Coordinator. Member of the Dry Lab - Design and Education group. She has helped with the search and establishment of protocols.
• Nathaly Romero: Art and Creativity Coordinator, Human Practices coordinator assistant, Dry Lab - Design group member. Co-created the graphic designs found in social media and created the design of the complementary material.  
• Bryan Cevallos: Member of the Dry Lab - Design group, helped with the search of the sequences to be used and in the design of the inhibitory hairpin, also in Human with interviews, and Education with expositions.
• Jonathan Bastidas: Member of the Human Practices group and part of Education, has contributed to scientific dissemination by giving talks to students and farmers. 
• Jessith Salinas: Member of the Dry Lab - Design group, in charge of the design and management of the SbolDesigner program, also member of the modeling and security group.
• Robert Ronquillo: Member of the Dry Lab - Design, Human Practices and Education committees. In addition, he collaborated in the safety protocol of the project.  
• Cristina Pilamunga: Member of the Dry Lab - Design, Human Practices, Art and Creativity and Education committees. 
• Sofía Garrido: Social media coordinator, creator of the graphic and visual identity. She has supported the Dry Lab - Design and Arts and Creativity committees. 
• Paola Ribadeneira: Member of the Dry Lab - Design, Human Practices and Route Design committees.
• Lizbeth Zamora: Participation in Dry Lab corresponding to the modeling area, specific work in 3D Model and participation in the education committee.  

Instructors

• Fernando Gonzalez: Continuous weekly progress review of the whole project, contribution of solutions with molecular biology techniques, handling of modeling software and organization of scientific dissemination talks on synthetic biology at university level. 
• Francisco Flores: Review of genetic circuits, in silico assembly. Advice in the approach of reactions and equations for modeling.  



Mentors

• Armando Reyna: Advice and technical correction in talks and conferences to socialize the problem. Liaison with the livestock sector.
• María Augusta Chávez: Contextualization of the problem of hemotropics at national level and its importance.

Volunteers

Figure 2. Volunteers. 

• Guillermo Flores: Developer and programmer of MATLAB scripts.
• Karolay Hernandez: Organization of Human Practices activities.
• Damián Quishpe: Contribution to a scientific briefing event.
• Mateo Molina: Contribution in the development of the MATLAB script and molecular docking model.
• Gabriela Sanchez: Contribution to a scientific briefing event.

2.1 Design Roadmap

Design Roadmap

At the national level, three potential problems were identified: (1) treatment of water contaminated by antibiotics, (2) plastic degradation and (3) detection of hemoparasites in cattle. Three working groups were carried out, in which each idea was investigated in greater depth to find an answer to a problem using synthetic biology. The idea chosen by democracy was the detection of hemoparasites in cattle! This was because the problems in the country have been neglected, despite the economic implications. In the past and up to the present, the detection of the disease in the field is carried out through the analysis of symptoms, although they are nonspecific and evident at a late stage. On the other hand, it is opted for the diagnosis by morphology, PCR and ELISA that require several days to reach the laboratory and be processed [1].

By way of brainstorming, it was proposed to use nucleases TALE, CRISPR-Cas13 or toehold switch to solve the problem. After analyzing the proposed options, we determined that TALE technology requires the production of a large molecule, which, being a protein structure, requires more production time. Furthermore, it is based on the interaction of amino acids and nucleotides. Every 33 amino acids a nucleotide is recognized, indicating the need to generate an extensive structure. Therefore, we prefer to opt for the interaction between nucleotide sequences rather than amino acid sequences. On the other hand, the application of CRISPR-Cas13 was discarded because it was not compatible with the team's goals of establishing a genetic circuit with a logic AND gate. So we opted for an innovative transcriptional level control technology like the toehold switch. We had initially proposed the design of separate toeholds, which recognize two different biomarkers, each required to activate reporter production. This process results in a long wait time. Due to this, to optimize the system, it was decided to design an inhibitory hairpin, that is, to incorporate both toeholds in a single RNA sequence that recognizes the two biomarkers in sequential order and activates the production of the reporter protein. Through modeling it was found that it requires less waiting time and in the cell free system there is less energy load, therefore, it is faster to produce the signal; unlike the three constructs, which involve more work for the system.

The initial idea we had as a team was the detection of hemoparasites in cattle. However, after having interviews with veterinary experts on the subject, the project focused on detecting babesiosis. In addition, the technology was selected based on synthetic biology, the system to be applied: toehold switch, discarding the nucleases TALE and CRISPR-Cas13. The final idea is a feasible option in the field and that responds to the needs of the livestock sector in our country, which allows us to contribute to responsible production and consumption, decent work and economic growth, together with the promotion of health and well-being. We are pioneers in proposing a solution with the application of synthetic biology to detect hemoparasites in the country, since it is a viable alternative for early detection. Our project uses a colorimetric signal that allows it to be executable in the field, in a specific way. In addition, we focus on a problem that affects and represents a risk of losses for farmers and the dairy and meat production chain. 

References

2.2 Excellence in Biological Engineering Design

A. TECHNOLOGY

Molecular marker selection for Babesia Bovis detection

We investigated the molecular markers of Babesia bovis, in this process we found that the "cytochrome b gene" encodes a mitochondrial protein and is an obligatory component in the respiratory chain of the protozoan, this molecular marker is used to detect and quantify B. bovis, because it has a higher number of copies than ribosomal genes [1]. In the same way, we determined that B. bovis, specifically chromosome 2, has a sequence that encodes the protein of the acyltransferase family BBOV_II006950, which we use as a molecular biomarker, because this protein participates in the metabolic cycle of B. bovis, In glycerophospholipid biosynthesis, the gene is also highly conserved [2].

With this information we identify 2 sequences: the first is the gene that encodes the acyltranferase proteins (XP_001610213.1) present in "T2Bo chromosome 2" that has 990 bp and presents 100% Per. Ident, 91% from Query Covery and 2 * e-151 from E. value. The second is "cytochrome b mitochondrial" (JX440511.1), which has 551 bp, which through a blast presents 100% Per. Ident and Query Covery, in addition to 0% in the E value, which will allow us to make a more precise detection of B. bovis in the field.

Riboswitches: Toehold switch

The Toehold Switch system consists of a synthetic RNA sequence, which like any mRNA can be translated. This sequence forms a hairpin secondary structure at the 5' end, which keeps access to the ribosome binding site (RBS) restricted, meaning that the switch is turned off and therefore cannot be translated. The Toehold Switch has a binding domain complementary to a sequence to be detected (Trigger binding site, TBS), once binding occurs, the hairpin opens releasing the RBS that regulates the translation of a reporter gene, and then, the system is turned on [3]. 

The RNA system as such is formed by the sequence corresponding to the TBS divided into two sections, one part is free to detect the trigger by pairing and the other is part of the secondary structure of the bottom stem of the fork. In the upper part of the fork (upper stem) a loop is formed containing the pre-RBS and RBS, keeping it inaccessible to ribosomes. In the middle part of the stem is the unpaired translation initiation codon (AUG), which is linked to the reporter gene by a pre-established linker sequence [3] (Figure 1).

Figure 1. Toehold Switch system. 1) Parts of Toehold Switch. 2) Identification of the Babesia bovis biomarker to select a trigger. 3) Activated Toehold Switch system that releases the RBS for the reporter gene expression. Source: iGEM Biotech EC.

Cell Free

A cell-free system will be used, characterized by its cost-effectiveness and versatility as a means of protein expression [4]. It is based on using the machinery of an organism in order to carry out a metabolic reaction or the synthesis of a protein, DNA or RNA in vitro and thereby understanding the design and how nature's systems work for construction and engineering testing [5]. To carry out this technique, we proposed to turn to Escherichia coli and use its biological machinery in order to produce the toehold switch necessary for the development of our screening test.

RPA

For this type of technology to work, a minimum concentration of the trigger is necessary, which requires a previous amplification method. Therefore, the use of isothermal amplification strategies that allow working in places with limited resources and in a short time, such as LAMP, NASBA and RPA that do not require thermocyclers, have been chosen [6]. Both methods have advantages [7]. However, RPA has an additional benefit as the amplification time is 20 - 40 min. In addition, it does not require isothermal or chemical fusion [8] and allows the use of poorly purified samples such as: whole blood, sputum and urine; therefore it is used as a complementary technique to other nucleic acid detection strategies that allow adapting to the cell-free system and allows increasing the sensitivity of the test [9].

B. BIOLOGICAL CIRCUITS

Circuit 1: Individual toehold switch system

We set out to construct a two-input AND logic gate that allows for increased specificity, reduced false positives [10] and tight regulation of the biosensor [11][15]. Our design is based on the σ54-dependent hrpR / hrpS system [12], for which two toeholds were designed with the ability to recognize two distinct trigger sequences, each expressing the coactivating genes hprR and hprS that when forming a heteromeric complex, this will be able to stimulate the inducible hprL promoter and allow the expression of the lacZ reporter gene, as shown in Figure 2. The kinetic reactions that take place during the assay were used to create differential equations that allowed us to develop a mathematical model which is detailed in section D.

Figure 2. Circuit 1 - Individual toehold switch system. Source: iGEM Biotech EC.

Circuit 2: AND gate optimization system - inhibitory hairpin

For the circuit described in the previous point to work correctly, 3 different constructs are necessary, which we believe may eventually alter the efficiency of the cell free system [13], in addition to the fact that the test would take more time (a fact that we checked with modeling, see section 5). Therefore, we decided to apply the parsimony principle and implement the AND logic gate in the same switch, using the inhibitory hairpin design by Kim and collaborators [14]. Therefore, a toehold switch with two hairpins was designed, the first one is partially formed of both TBSs, while the second one is made up of part of the second TBS, the RBS and the initiation codon AUG. This structure expresses the lacZ reporter gene only if sequential binding of the triggers to be detected in the respective TBSs occurs (Figure 3). 

During the construction of this gate we took into account the length of the sequences "a" and "b", since if "b" is very large, the probability of activating the system without the second trigger binding to the switch increases, giving rise to a single input circuit or OR logic gate [14]. The objective of this circuit is to decrease the work to be done by the cell free system and increase the efficiency of the biosensor, i.e., we seek to optimize circuit number 1, so we established an appropriate model detailed in section D.

Figure 3. Circuit 2 - Inhibitory hairpin system. Source: iGEM Biotech EC.

Design in SBOL Designer

To schematize the circuit design of both the AND gate optimization system - inhibitory hairpin and the individual toeholds system, we used the program "SBOL Designer", as for the pre-existing iGEM parts, we imported the sequences directly from the IGem parts repository, which is linked to SynBioHub. In order to import the sequences of the created parts, we generate fasta files using the "ClustalX2" program.

Figure 4. Schematics of designed toehold switch circuits a) Toehold switch HrpR expressor, b) Toehold switch HrpS expressor, c) Reporter construct, d) Hairpin Inhibitory LacZ expressor. Source: iGEM Biotech EC.

C.  DESIGN

Toehold Switch design and construction 

The criteria to be considered for the design of the biosensor were:

• The secondary structure of the toehold switch. 
• Certain thermodynamic parameters such as:

- Gibbs free energy of trigger (∆Gt), switch (∆Gs), mRNA (∆GmRNA), complex formation (∆Gc), net free energy ( ∆Gn= ∆Gc - ∆Gs - ∆Gt), ∆GRBS-linker, ∆Gupper stem-linker

- The GC percentage of the trigger binding site (TBS)

- Trigger specificity 

- Normalized ensemble defect (NED)

Note: See Documents section/Project Supporting information: "1_Parameters_Toeholdswitch_design"  file where you can find the meaning of each thermodynamic parameter. 

The free energy value of the toehold switch-trigger complex must be more negative than the free energy of the unbound state to favor complex formation and allow switch activation (∆Gc≤ ∆Gs + ∆Gt) [16]. In contrast, a more negative value of ∆GRBS-linker and ∆Gupper stem-linker indicates that these parts of the switch form more readily secondary structures, which would affect the translation efficiency, therefore, these values are preferred to be closer to 0 kcal/mol. On the other hand, it has been reported that the GC content of TBS in a toehold switch can vary between 20- 60%, which implies as a requirement some A - U base pairing in this domain [3][17]. The higher the GC content of the TBS, more stable is the toehold switch sequence, however a high stability could prevent binding to the sequence to be detected and will favor the OFF state of the switch. 

We also considered the normalized ensemble defect NED, which is the average percentage of nucleotides that are incorrectly paired at equilibrium relative to the specified secondary structure (if the value is closer to 0% it is better) [18]. Furthermore, it was contemplated that the trigger binding domain should have less than four consecutive base pairs (A,G,C,U), as it may cause instability in the switch structure [http://2017.igem.org/Team:Hong_Kong-CUHK/Software][19]. Another important aspect is that the bottom stem should not contain stop codons to avoid repression of translation of the reporter protein [19]. 

Circuit 1 design

For the switches structure we considered a length of 30 nts to the trigger binding site, the GGG leader sequence at the 5' end to improve the transcription efficiency by T7 RNA polymerase, 3W (A,U) at the upper stem to open the switch easily, a 15 nts sequence for the loop containing the pre-RBS (CAGAAAC) and RBS (AGAGGAGA) and the 21 nts linker (AACCUGGCGGGGCAGCGCAAAAG) [3][8][20][22].

The following scheme shows the process to follow to obtain the sequence and secondary structure of our toehold switches. 

The design was performed in the Toeholder program developed by the iGEM Ulaval 2019 team. This program allowed obtaining libraries of possible triggers and their respective toehold switches designed according to the most optimal consensus structure reported by [3], taking as input only the sequence of the 2 target genes selected by our team. Next, the pre-selection phase was performed, in this section we chose those toehold switches that satisfied the following criteria: 35-45% GC, ∆Gc≤ ∆Gs + ∆GmRNA kcal/mol and the triggers specificity for Babesia bovis obtained using the BLAST program. In other words, it was verified that the sequences did not contain homologous regions that correspond to other common hemotropic microorganisms that can inhabit the cattle body. Then the selection phase was performed, for which the analysis section of the online NUPACK program was used, it allowed predicting the free energy of switches (∆Gs) as triggers (∆Gt) and the secondary structure of the MFE RNA (minimum free energy RNA) at 37 ℃ [18]. 

In addition, ∆GRBS-linker, ∆Gupper stem-linker and NED were obtained from each of the switches of the two libraries corresponding to each biomarker (Figure 5 and 6). Subsequently, in the BLAST program, the selected triggers were compared with the internal control sequences belonging to the Bos Taurus genome and no results were obtained, indicating the non-existence of identities.

We used the RNAup web server of the Vienna RNA Package [22] also applied by the iGEM CSMU 2020 team [23] in order to simulate the interaction between the sequences of the toehold-trigger complex and determine the energy state. As a result we obtained a graphical scheme (∆G vs. position) in which the black line represents the amount of energy required to open the TBS without the presence of the trigger, whereas the red line represents the amount of energy required to open the TBS once it binds to the trigger. As an example, we note that in one of the toehold sequence selected for acyltransferase T2Bo, the energy state is more favorable (∆G more negative) for the toehold-trigger complex formed, so it will unfold spontaneously upon detection of the target sequence (red line), while, in the absence of the trigger, the secondary structure formed by the toehold will not open on its own (black line) (Figure 5E). 

Figure 5. Results of NUPACK and RNA Vienna analysis of the toehold switch and trigger selected for the biomarker 1: Babesia bovis acyltransferase T2Bo gene. Source: iGEM Biotech EC.

Figure 6. Results of NUPACK and RNA Vienna analysis of the toehold switch and trigger selected for the biomarker 2: Babesia bovis isolate boLushi cytochrome b gene. Source: iGEM Biotech EC.

Note: See Documents section/Project Supporting information: "2_Results_Individual toehold switch_design"  file where you can find the results obtained in the programs Toeholder, NUPACK and RNA Vienna.

Circuit 2 design

In the inhibitory hairpin, the first hairpin is required to lack AUG and RBS and according to [14] it has been established that the region "a" is equal to 11 nts and "b" is 4 nts, so that the circuit behaves as an AND gate. That is, a short spacing between the hairpins allows the positive cooperative binding of the second trigger (the smaller the "b" spacing, the higher the Hill coefficient, although the correlation is low R2=0.52) promoting a sequential binding [14]. Similarly to the initial circuit, a GGG leader sequence was considered, trigger binding domains of 30 nts each, the first TBS is that of cytochrome b and the second is that of acyltransferase T2Bo, a length of "b" of 4 nts, 3W (A,U) in the upper stem of the second hairpin below the loop containing the same pre-RBS sequence, the RBS and linker respectively [3][8][20][21][24]. 

The following scheme shows the process to follow to obtain the sequence and secondary structure of our inhibitory hairpin.

To design the inhibitory hairpin, we used the online NUPACK program. The thermodynamic analysis and switch selection criteria for the inhibitory hairpin were the same as those used for the individual switches (Gn, %GC, specificity, ∆GRBS-linker, ∆Gupper stem-linker and NED).

We also simulated the interaction of inhibitory hairpin with both sequences to be detected with the Vienna RNA Package RNAup web server. Each interaction was analyzed separately, as each trigger interacts independently in the specific order (cytochrome b first and then acyltransferase T2Bo). We observed that each interaction with the respective trigger shows a more favorable energy state (∆G more negative) for the complex formed, allowing us to predict that once the second trigger binds the structure will unfold spontaneously allowing expression of the reporter gene. 

Figure 7. Results of NUPACK and RNA Vienna analysis of the inhibitory hairpin with both sequences to be detected (Babesia bovis isolate boLushi cytochrome b gene and Babesia bovis acyltransferase T2Bo gene). Source: iGEM Biotech EC.

Note: See Documents section/Project Supporting information:  "desing script" and "3_Results_ inhibitory hairpin_design" files where you can find the desing script used in NUPACK program and results obtained in the programs Toeholder, NUPACK and RNA Vienna.

Internal control

Our design proposes to have an internal control using as sample the cow DNA obtained after sample treatment and extraction [25]. The sequence to be detected is naturally present in the sample, regardless of the presence of T2Bo: acetyl transferase and the cyt b gene. The aim of this control is to verify that the steps of DNA extraction, amplification and the integrity of the cell free system reagents are working correctly. Therefore, we investigated biomarkers that are able to detect a control sample of Bos taurus (cow) and discriminate against our parasite. One of the genes used was mitochondrial because it has been shown that it can help in the identification of animals of the genus Bos [26].

The sequences we worked with are: "TGGATCCTGCATCTTCATTCCACACCAATT" Bos taurus genomic sequence NC_037356.1 (3373-3399) and "CTACTACTACTCTCGCTCCCTGTATTAGCA" Bos taurus mitochondrion sequence were chosen for their usefulness in barcoding this species. We performed a search in the BLAST program and were able to identify that they are specific, so there is no cross-reaction with other sequences of hemotropic pathogens. These sequences can detect the presence of Bos taurus and can generate a report of it.

Note: The same design was considered for constructing an internal control using Bos Taurus specific sequences. See Documents section/Project Supporting information: "4_Results_internal control_design" file where you can find the results obtained in the programs Toeholder, NUPACK and RNA Vienna. 

RPA Design 

In order to design primers that work under RPA conditions, we should consider the following aspects [27]:

- Primer length should be around 30 to 35 bp.

- GC content of primers should be around 30 to 70%.

- Desirable melting temperatures (Tm) 55- 80 ºC.

- 3’ terminal ends do not be complementary to the other primer avoiding dimer formation. 

- Amplicon lengths might have 100 and 250 nucleotides, which usually incur fast and efficient amplification.

- Guanines at 5’ terminal are detrimental. Also, it is highly recommended to avoid primers that have 3 or more C o G at the terminal regions. 

- Guanines and Cytidines at the 3’ terminal increase performance.

- Finally, for an efficient transcription by a T7 RNA Polymerase, we added a T7 promoter sequence at the 5’ terminal of each forward primer. The uneven addition does not represent any inconvenience as it is reported by team iGEM Leiden 2020 that develops a rapid method for detecting SARS-CoV-2 using a similar methodology [28]. 

Table 1. RPA designed primers.

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  and "6_RPA_Primers_design and Analysis" files where you can find Table 1 and the RPA primers design results respectively.

D. MODELING

RPA: Recombinase Polymerase Amplification

We decided to model RPA to establish the approximate timing of our test and to understand the behavior of the molecular reactions during amplification. To date only RPA has been modeled twice [29] [30]. So we wanted to establish a simple model than the one proposed by Moody in 2016. In creating our own model we found that there is a lack of characterization of complex formation and dissociation constants, however all rate constants were obtained from Moody, 2016.

• Mechanism

The UvsX-UvsY complex (recombinase complex, RC) binds to the primer (F) forming a UvsX-UvsY-ssDNA nucleoprotein filament (RCF, reaction 1) [31] [32] [33]. The complex searches for homologous sections in the DNA (D), when it finds them it forms a D-loop structure, giving rise to the primer-recombinase-DNA complex (RCFD, reaction 2). SSB proteins (Gp32) bind to the opposite DNA strand to which the RCF complex was attached in order to stabilize the strand and prevent the primer from being ejected [27]. That is, one side of the D-loop is double-stranded where the primer hybridizes to the template strand, while the other side remains single-stranded and is stabilized by the SSB proteins. ATP hydrolysis allows the recombinase to exit the RCFD complex leaving the primer bound to the DNA (FD, reaction 3). The primer is incorporated into the DNA with the help of DNA polymerase (P, Bsu or Sau) forming the PFD complex which initiates polymerization at the free 3'-OH end in the primer (see reaction 4a, 4b) [27] [29] [30]. The addition of dNTPs allows the formation of the complementary strand. The incorporation of direct and reverse primers allows the synthesis of strands in both directions simultaneously [29].

Figure 8. RPA mechanism. Source: [34]. 

• RPA detection limit

To establish what is the minimum DNA input concentration needed to start the amplification reaction, we rely on the formula proposed by Thessaly Team 2019. We consider that 1 bp is 660 daltons ( 660 g/mol ) and 1647 bp like the length of the DNA template.

[DNA] = 1,805*10-9 ng found in 1 copy

We selected 1 ul of DNA template for each amplification reaction [34]. Transforming the concentration from ng/ul to M, we obtained a DNA input equal to 2.73*10-15M. 

• Considerations for the kinetic model

Our model takes into account 8 biochemical species, 4 stages, 5 reactions and makes the following considerations:

- The reactions below were established for the forward primer. 

- The recombinase complex will function only when the UvsY charge factor is bound to the UvsX recombinase. 

- ATP is constant due to the presence of phosphocreatine kinase.

- Gp32 protein (SSB) has a sufficient and non-limiting concentration, moreover it will bind only to the complementary chain to which the recombinase-primer complex was bound, therefore it is not considered in the model.

- Degradation of proteins and DNA is not taken into account because the literature dictates that the reaction time is 20-40 min, and the half-life of biomolecules exceeds this time [35].

- The concentration of pyrophosphate is not sufficient to degrade the DNA strands.  

- The concentration of dNTPS is sufficient and not limiting during the whole process.

• Reactions

To establish the kinetic model of isothermal amplification we established 4 reactions as follows.

1. Formation of the recombinase primer complex.

RC + F → RCF

2. Formation of the D-loop and the recombinase-primer-DNA complex

RCF + D → RCFD

3. Formation of the primer-DNA complex (recombinase output).

RCFD → FD+RC

4. Amplification

a. FD+P ↔ PFD

b. PFD → P+2D

• Equations

From the reactions, we established the differential equations that would allow us to predict the behavior of the biochemical species over time, for this, we used the law of mass action and Matlab software. 

Table 2. Description of equations for RPA modeling

Table 3. Kinetic parameters for the RPA model

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  and  "7_model script_MATLAB" files where you can find Table 2, 3 and RPA model script respectively.

• Results

As we observe in the graphs, the concentration of the RCF and F complexes decrease over time as the primer is being consumed. The RCFD, PFD and FD complexes have a similar behavior over time with a concave shape, at 3 minutes long the three species reach their maximum concentration and since amplification starts at that point the concentrations decrease again. Recombinase (RC) and polymerase (P) show similar behaviors since they are initially available and as they form complexes their concentration decreases. As the primer is depleted both species become available again so their concentration increases. Finally, the DNA vs time graph exhibits a logarithmic growth up to 10 min, which demonstrates the speed of this type of amplification, since according to the literature the RPA has an ideal reaction time of 20 min [35].

Figure 9. Graphs of the different species involved in the isothermal amplification reaction.

Individual toehold system model

Initially, the mathematical model for the individual toehold system described in section A was proposed to predict its behavior in a cell free environment and based on the results obtained, the possibility of further optimizing the model by means of the inhibitory hairpin system was proposed, which is discussed below.

• Biochemical reactions

In both constructs 1 and 2, we first established the toehold switch transcription reaction, which depends on the constitutive transcription rate, in this case we decided to use the T7 promoter, because it can produce high levels of transcription [36]. In contrast, the DNA trigger sequences come from RPA amplification and are transcribed to RNA in the presence of T7 RNA polymerase (component of the cell free system used for our detection test). Once the trigger and toehold switch are found as RNA in the medium, the Active 1 and Active 2 complex (between both sequences) formation occurs (third reaction), thus activating the system, which allows the expression of the coactivating genes HprR (Transcriptional regulatory protein) and HprS (Sensor histidine kinase) respectively (Figure 10 and 11). HprR and HprS then form a heteromeric HprRS complex, (first reaction in construct 3), capable of stimulating the inducible promoter PhprL, which will allow transcription and subsequent translation of the lacZ reporter gene giving rise to the β-galactosidase enzyme (Figure 12). In addition, RNA and protein degradation reactions were defined as appropriate for each construct.

Figure 10. Biochemical reactions corresponding to construct 1.

Figure 11. Biochemical reactions corresponding to construct 2.

Figure 12. Biochemical reactions corresponding to construct 3.

• Differential equations 

The model developed in MATLAB includes the evolution of 12 species as a function of time, we apply literature-based reaction rates to establish a simulation that allows us to predict the performance of the test and the time it would take until the result is observable.

Table 4. Description of equations for Individual toehold system model.

Table 5. Parameters used for individual toehold system model.

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  and  "7_model script_MATLAB" files where you can find Table 4, 5 and Individual toehold system model script respectively.

• Results

Figures 13 and 14 correspond to the mathematical interpretation of construct 1 and 2 of circuit 1, the same ones that represent the individual toehold switches and behave in an analogous way. To1 mRNA, Tr1 mRNA and active 1 complex graphs show similar behaviors since the first two represent the number of transcribed molecules and the third will increase their concentration as To1 and Tr1 mRNA bind. Active complex formation allows the expression of the HrpR protein. This means that at the C1 concentration there is a gradual increase in a time of 30 minutes and a lower probability that this molecule forms a complex with HrpS. On the other hand, at a high concentration of DNA (C3 and C2) the probability of forming the heterometric complex is higher, for this reason HrpS protein is observed in a null concentration. These results agree with those obtained from construct 2 (figure 14).

Figure 13. Modeling of the chemical species of the first construct, considering different concentrations of pathogen DNA in the sample: C1: 100 molecules (unamplified concentration); C2: 2,535 * 105 molecules (concentration for incomplete amplification); C3: 2,535 * 106 molecules (concentration for successful amplification)

Figure 14. Modeling of the chemical species of the second construct, considering different concentrations of pathogen DNA in the sample: C1: 100 molecules (unamplified concentration); C2: 2,535 * 105 molecules (concentration for incomplete amplification); C3: 2,535 * 106 molecules (concentration for successful amplification).

Figure 15 shows an increase in the concentration of the HprRS complex for the C3 and C2 concentration (are overlapping), this agrees with the results obtained in Figures 13 and 14, because of at a high concentration of DNA it causes an overexpression of the system and therefore of the complex HprRS. The P(hprL) * HrpRS complex increases, same as the B-galactosidase concentration.

Figure 15. Modeling of the chemical species of the third construct, considering different concentrations of pathogen DNA in the sample: C1: 100 molecules (unamplified concentration); C2: 2,535 * 105 molecules (concentration for incomplete amplification); C3: 2,535 * 106 molecules (concentration for successful amplification).

AND gate optimization: Inhibitory hairpin system model

We applied the concept of parsimony in order to find a simpler and more effective construct for the detection of Babesia bovis sequences, with the aim of optimizing the design, resources and time at the time of the test. In this case, we required fewer biochemical reactions and differential equations for the mathematical model.

• Biochemical reactions

We initially set up the constitutive transcription reaction of the inhibitory hairpin sequence (To_RNA) from plasmid pBR322 [37]. The DNA trigger sequences (Tr1_DNA and Tr2_DNA) come from RPA amplification considering different concentrations of the amplification product these sequences are transcribed to RNA (Tr1_RNA and Tr2_DNA) in the presence of RNA polymerase T7 found in the screening test. Next, we represent the interaction equations of the toehold with each of the triggers in sequential order [34] [38], as the first trigger binds, a semiactive structure is formed (semiactive) that exposes the second TBS, which allows the binding of the second trigger, activating the system (active) that allows the expression of the LacZ gene encoding the b-galactosidase reporter protein. 

Figure 16. Biochemical reactions corresponding to the inhibitory hairpin construct. 

• Differential equations 

Basically, the model developed in MATLAB includes the evolution of six species as a function of time. We apply reaction rates based on literature to establish a simulation that allows us to predict the performance of the test and the time it would take until the result is observable.

Table 6. Equations used for the hairpin inhibitory model

Table 7. Parameters used for inhibitory hairpin system model 

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  and  "7_model script_MATLAB" files where you can find Table 6, 7 and inhibitory hairpin system model script respectively.

• Results

Figure 17. Modeling of the biochemical species from the inhibitory hairpin model considering different concentrations of pathogen DNA in the sample: C1: 100 molecules (unamplified concentration); C2: 2,535 * 105 molecules (concentration for incomplete amplification); C3: 2,535 * 106 molecules (concentration for successful amplification).

From the differential equations of the mathematical model, we obtain the graphs corresponding to each chemical species involved in the design using MATLAB. To_RNA accumulates due to being in exces if the amplification is successful. If there is no amplification or it is incomplete, To_RNA does not accumulate because everything reacts. A similar case is observed in Tr1_RNA and Tr2_RNA, with the difference that in an incomplete reaction it accumulates lower than a successful amplification. If the amplification is complete or incomplete, the Semiactive complex does not accumulate because there is a large amount of trigger and everything reacts to form the active complex, while if there is no amplification, the Semiactive complex accumulates as there is not enough trigger to bind. Finally, in a successful or incomplete amplification, the same levels of active complex and therefore of the β-galactosidase enzyme can be obtained, this means that the system self-regulates to reach a production peak. Without amplification, production is reduced.

Models Analysis 

Table 8. Comparison of Toehold systems models 

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  files where you can find Table 8. 

Comparing the toehold systems proposed, the inhibitory Hairpin system takes less time to start the production of β-galactosidase, however it achieves lower production levels than the individual toeholds system, therefore the need to perform an in vitro characterization of the models proposed. It is worth mentioning that both models have been considered as deterministic. The inhibitory Hairpin system has fewer intervening chemical species, it is direct and parsimonious, so a deterministic model is adequate. The individual toeholds model is not parsimonious, it has more chemical species and therefore it is susceptible to interferences, so a stochastic model could be the best option to explain this system, this means we need to perform experiments and change our actual model in order to adapt it to the data.

Also, we need to determine the minimal galactosidase concentration needed to obtain a positive reaction, and then determine the time when our optimized system (inhibitory hairpin) reaches it. Finally, we have to consider that the inhibitory hairpin system is cheaper than the individual toehold system.

Figure 18. Comparison of β-galactosidase produced by our Toehold systems.

Enzymatic model

Since our detection test is based on being colorimetric to know whether the sample is positive or negative, we chose the red chlorophenol β-D-galactopyranoside (CPRG) as substrate, which changes from yellow to purple in the presence of the enzyme galactosidase. In order to know the behavior of the enzyme galactosidase in the presence of this substrate, we propose below its kinetic model. 

For our proposed model we decided to base ourselves on a model made by the iGEM Lambert_GA team [39], who used Ortho-nitrophenyl-β-galactoside (ONPG) and β-galactosidase as substrate and β-galactosidase as enzyme. It should be emphasized that we adapted the values of kinetic constants, biochemical reactions, times and substrate and enzyme concentrations according to our requirements, since our substrate is CPRG and therefore the enzyme describes a different behavior. The estimated time to start seeing the enzymatic activity is 30min [40], however the time can be extended up to 60min [41] to observe the total coloration change, with this in mind, the changes in the system constants were raised. 

The behavior of β-galactosidase in the presence of CPRG forms an enzyme-substrate complex to then cleave CPR, galactose and finally the released enzyme. The biochemical reactions and their constants are described as follows:

Table 9. Parameters used for enzymatic model

We got 3 differential equations:

Table 10. Equations for enzymatic model

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  and  "7_model script_MATLAB" files where you can find Table 9, 10 and enzymatic model script respectively.

Next, we defined the model in the MATLAB program, obtaining the following results:

• Results

Figure 18 shows that the β-galactosidase / CPRG complex is formed immediately and in high quantity after the reaction starts, due to the fact that a high concentration of β-galactosidase has been obtained from the toehold systems that binds immediately to CPRG. The metabolic reaction does not occur immediately, but progresses periodically, until at 30 min all the substrate has been exhausted, the complex has reacted and all the possible amount of CPR has been produced. From the graph it can be concluded that after 20 minutes it can be seen if the sample had a positive or negative reaction. After 30 minutes the result can be concluded with certainty because all the substrate is exhausted and the reaction is complete.

Figure 19. Modeling of the β-galactosidase / CPRG complex formation and CPR production as a reporter.

Total test time determination 

From the estimated times according to the protocols and modeling, it is concluded that the test takes about 3 hours.

Table 11. Total test time

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  file where you can find Table 11.

RNA 3D modeling

The RNA 3D structure prediction of the individual toeholds and the inhibitory hairpin designed for the biomarkers (mitochondrial cytochrome b gene and T2Bo chromosome 2) used in the project have been developed through the RNAComposer online server (http://rnacomposer.cs.put.poznan.pl) and PyMol software (https://pymol.org/2/) for visualization of the obtained structures.

RNAComposer is based on the translation machine concept and uses the RNA FRABASE database to relate RNA secondary structure and tertiary structure. Its input is limited to sequences of no more than 500 nucleotides and consists of three lines, the first is intended for the molecule name to be analyzed, the second line corresponds to the RNA sequence (A, C, G, U), while the third line is the RNA secondary structure encoded with dots (.) and parentheses [42]. Subsequently, the files in pdb format, generated in RNAComposer have been read by PyMol to observe the 3D structure (Figures 20-22). 

Figure 20. 3D structure of individual toehold designed for biomarker: mitochondrial cytochrome b gene.

Figura 21. 3D structure of individual toehold of the chromosome 2 biomarker: T2Bo.

Figura 22.  Inhibitory Hairpin 3D structure.

See our 3D videos:

Video 1: 3D structure of individual toehold

Video 2:  Inhibitory Hairpin 3D structure

Molecular Docking 

The site prediction and the binding posture of the toehold and trigger was carried out by means of the RLDOCK program (Figure 23). This software predicts the ligand binding sites and their binding pose, using a search algorithm and the ligand energy evaluation [43]. Nevertheless, the docking study is completed by comparing the predicted result with the crystalline structure of the molecules that make up the riboswitch, obtained by X-ray crystallography.

The molecular docking  functionality helps to understand how the affinity degree and how the ligand and receptor interact. In our cell-free system, the interaction between the trigger and the toehold system developed. In the riboswitches behavior, a structural change in ligand binding is a fundamental feature [44]. On the other hand, software limitation is the RNA conformational multiplicity and its flexibility binding sites to modify the binding affinity of the ligand. RLDOCK assumes a rigid RNA structure. Therefore, RNA conformational changes upon binding to the ligand are not treatable [43].

Figure 23. Interaction between the trigger (Babesia bovis) and the toehold of the system developed. Light blue: trigger, pink: toehold T2Bo, yellow: binding sites.

E. BUILD AND TEST

Our circuit design is ready to be taken to the construction and testing phase, as we conducted a review of the materials, equipment and methods to be applied to test our design. 

• Construction 

During development of our EC Bab test, we generated a total of 10 parts (Table 14) and used 9 pre-existing parts in iGEM. In order that these can be used by anyone interested in our work, we chose the RFC 10 method as the standard assembly method, this is the optimal one, because for the first circuit the sequence of the switches will be synthesized in a single fragment and the construct in which the reporter gene is located in a second fragment, i.e. the assembly of three parts will be performed. Similarly, for the second circuit, the entire inhibitory hairpin will be in a single fragment, so only two parts will need to be assembled. For both cases the pSB1C3 vector will be used, which is a high copy number plasmid, in addition to being RFC 10 compatible and known to work well in cell free systems [34],[45].

Figure 24. iDLBB_001457 and iDLBB_001460 plasmids in Benchling.

• Verification test of the length of the constructs

All fragments needed to construct the plasmid vector should be digested according to the RFC10 assembly and the length of each digested fragment should be checked using an electrophoresis gel.

• DNA extraction and RPA

To verify the designed primers specificity, we propose to perform a specificity test where we will use DNA samples from other common hemotropics in cattle (Trypanosoma spp. and Anaplasma marginale), and DNA from a healthy cow and water as negative controls [46].

To determine the detection limit of RPA we will test the primers at increasingly lower concentrations of B. bovis DNA and the presence of amplicons will be assessed by electrophoresis. Ideally, the results obtained should be compared with the sensitivity indicated by a previously performed PCR test. This will validate the limit of detection that our RPA amplification design would have. In addition, to verify the presence and amount of amplicons, it is recommended to perform a 15%-UREA-page test [47].

On the other hand, it is necessary to check if the Babesia DNA extraction proposed in our protocol was successfully performed. We propose to perform a lysis of the red blood cell pellet obtained thanks to the centrifugation of bovine blood. This lysis is performed using FTA paper. This procedure allows the extraction of Babesia DNA since, according to its biological cycle, this parasite is located within the hematocrits. To make sure that this extraction has been performed correctly, we propose to perform an amplification with our previously described RPA, then an electrophoresis in order to check that the amplification and the extraction have been performed correctly.

• How much plasmid should the cell free system be put in? 

To know the amount of plasmid needed to add in the cell free system, it is necessary to perform laboratory tests, in a trial and error manner. To do this, it is first necessary to know how much plasmid was obtained from the transformed bacteria. So, we can perform lab tests with different plasmid concentrations, so that we can know the minimum amount necessary for it to work, thus optimizing this system.

• Functionality of toehold switches 

We will experimentally test the designed toeholds switches in silico to evaluate their functionality using the ON/OFF relationship. For this purpose, plasmids containing the designed circuits are transcribed and translated with the PURExpress kit (New England Biolabs). The visible readout of the assay uses the β-galactosidase reporter protein that in the presence of the substrate CPRG (chlorophenol red B-D-galactopyranoside) produces a color change from yellow (420 nm) to purple (570 nm) when hydrolyzed [40]. We chose this substrate because of its high sensitivity (it is up to 10 times more sensitive than ONPG) and because the color change produced is evident to the eye, unlike other substrates such as ONPG and X-gal that cause false positives or false negatives depending on the operator's eyes [48]. In order to obtain the ON/OFF ratio (ON: sample where the toehold switch and trigger are added, OFF: sample only with the switch, without the specific trigger to be detected) of the toehold switches designed in silico, we intend to measure the absorbance of CPRG at 420 nm and chlorophenol at 570 nm by spectrophotometer and then obtain the A570 nm/A420 nm ratio. We will then calculate the ON/OFF ratio, knowing that if this is < 1, it means that there is a measurement error, if it is equal to 1 there is no regulation and if it is > 1 there is a successful regulation [23][49][50].   

In the experimental design to test our AND logic gate functionality of both circuits with individual toeholds and inhibitory hairpin we will consider Table 12, where “1” means certain concentration in mg/ml and “0” no concentration mg/ml trigger. 

Table 12. Experimental design to test the toehold switches functionality

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  file where you can find Table 12.

• Sensitivity test of toehold switches 

We propose to perform a sensitivity test to ensure that the AND circuit is able to detect a minimal amount of Babesia bovis RNA and that the output signal is high enough to be displayed. We considered including a gradient of trigger concentrations to measure the sensitivity of the system. We then added a certain concentration of substrate and measured the absorbance with the spectrophotometer at a wavelength of 570-595 nm (570 nm is the maximum absorbance) [40].

• Specificity test 

We suggest a specificity test using common hemotropic sequences in cattle (Trypanosoma sp., Anaplasma sp.) to observe whether the switches will be accidentally activated in the presence of sequences unrelated to the target to be detected. The toehold switches that show an ON/OFF ratio > 1 and high sensitivity will be chosen for specificity testing. We will evaluate the absorbance of CPRG hydrolysis in the presence of the transcribed amplicons (specific triggers for the designed switches) as those common nonspecific triggers in the cattle and the negative control. The ON/OFF ratio of the designed toehold switches should be checked to be ≤ 1 in the presence of non-related sequences [49]. 

Those toehold switches with an ON/OFF ratio less than 1 can be optimized with the online tool STORM [23].

• Cell free system

To ensure that our cell-free system works properly in the laboratory, we recommend performing a Bradford assay to measure the concentration of protein present. For this technique the equipment to be used are vortex, centrifuge and spectrophotometer. According to Levine and collaborators [51], this concentration should range between 30-50 mg/mL. We recommend enriching the extract with magnesium, as it is important for replication, transcription and translation processes. However, this amount should be obtained by a lab test to know the appropriate amount depending on the cell extract and the amount of total protein present in order to minimize the amount of extract needed, thus optimizing the cell-free system. 

• Color change test

Finally, to prove that our test design works correctly, we propose to use synthetic triggers of Babesia bovis, which would be added to an extract of a cell-free system together with the toehold switch and if the color changes from yellow to purple, a positive test would be verified. Likewise, it will be tested with a negative control where only the toehold switch was added, in which the color should not present changes. Absorbances are measured at 420 nm and 570 nm in order to obtain a fold change value, i.e., how much the quantity changes between an original and a subsequent measurement [47]. For more information see the "Protocols" appendix.

F. PROTOCOLS

Note: See Documents section/Project Supporting information: "8_protocols_iGEM Biotech EC"  file where you can find proposed by our team.

G. BIOLOGICAL PARTS

Our project generated 10 new parts for the design of both circuits (individual toehold switch system and inhibitory hairpin), 5 new parts for the internal control and we integrated 9 existing parts. The newly created parts can be used for other iGEM teams to perform experimental tests, improve the parts and understand the basic mechanism of toehold switches. In addition, they can apply the genetic devices in different situations. Our designed constructs are composed of existing basic parts such as: 

• HrpL promoter (BBa_K1014002), LacZ reporter (BBa_l732005), Ribosomal binding site (BBa_J61100), Terminator (Bba_B0010) were used in the reporter construct of individual toehold system logical AND gate and internal control. 
• HrpR (BBa_K1014001 ) and HrpS (BBa_K1014000) were used in the design of the first circuit in the individual toehold system for the AND gate and internal control. 
• T7 promoter (BBa_I719005) for the construction of the single toeholds, the double hairpin and the internal control. 

Table 13. Pre-existing parts in iGEM Registry.

Table 14. Parts of Toehold switches created.

Table 15. Internal Control Parts created.

Note: See Documents section/Project Supporting information: "5_tables_design_iGEM Biotech EC"  file where you can find Table 13 - 15.

References

2.3. Human Practices

In iGEM Biotech EC, we are focused on solving the diagnostic complexity of Babesia bovis. A hemoparasite causing the disease bovine Babesiosis that happens to be the most relevant pathology in Ecuador, due to its difficulty in detection procedures, pathogenicity, repercussions in bovine health and that has been recently reported in temperate and cold zones, That’s crazy right?, since it was believed that hemotropic diseases were exclusive of tropical or subtropical climates.

So we decided to design a paper-based screening test for Babesia bovis using Toehold Switch technology. We saw that through Synthetic Biology it is possible to design a molecular tool that would allow us to specifically detect a genomic region of Babesia bovis. This technology is activated in the presence of a Babesia biomarker, as an alternative to conventional detection methods. 

We took as a starting point several designs previously used by iGEM teams, to couple to our bovine Babesiosis detection system. Among them are the bovine tuberculosis detection system, which tracks a Mycobacterium bovis RNA sequence, developed by the iGEM EXETER team [1]. We also rely on a method to detect oral cancer in humans using miRNA as a biomarker [2] and a technique to detect minute concentrations of airborne pathogens [3].

2.4. Integrated Human Practices.

Only 30% of cows infected with Babesia bovis manage to survive.

 Ing. Daniela Vera

Agronomist specializing in dairy cattle.

• Purpose: Know the current situation of hemoparasitic diseases in Ecuadorian livestock.
• Feedback: Babesia bovis is pathogenic, clinical signs include fever, hemoglobinuria, anorexia, jaundice, and even nervous signs. It is often confused with anaplasmosis and outbreaks of the disease have recently been reported in areas with temperate climates. 
• Action: The interview with the expert helped us to focus on the diagnosis of bovine Babesiosis

The diagnosis of Babesia bovis is complex because there are no cheap tests and eradication of the parasite in endemic areas is not recommended.

 Dr. Armando Reina

Veterinary Doctor

• Purpose: Study the limitations and advantages of hemotropic diagnostic methods.
• Feedback: Babesia bovis and Babesia bigemina are prominent in Africa, Asia, Australia and Central-South America, their spread being incited by human action and climate change. Once cattle are vaccinated, acquired immunity is based on activation of CD4+ T cells and antibodies [4]. In endemic areas where infections occur year-round, cattle acquire immunity after infection at an early age. Endemic stability may be affected by climate or factors that decrease tick reproduction and transmission, because it would prevent infection at the expected age.
• Action: This interview helped us to reflect on whether synthetic biology is the best tool to develop a qualitative and quantitative detection of Babesia bovis. Due to the costs involved in working with both characteristics, we opted for the test to be only qualitative, but in the future, with better knowledge and understanding of the system, we are preparing to design a test that not only detects the presence of the hemoparasite but is also capable of quantifying the levels at which it is found [5].

Babesia bovis causes sequestration of infected erythrocytes in brain capillaries occurs.

Dra. María Augusta Chávez 

Veterinary Doctor

• Purpose: Understanding the mechanism of infection of Babesia bovis. 
• Feedback: Babesia species are transmitted by ticks of the genus Rhipicephalus microplus that become infected by ingesting parasites, found in the blood of infected cattle and transmit it to others [7]. The tick sucks blood and inoculates the Babesia sporozoites that are introduced into the red blood cells of the bovine, where they transform into trophozoites to invade new red blood cells, after 24 hours the trophozoites penetrate the intestinal cells and transform into vermiculite, that break these cells and pass to the intestinal lumen, where they remain for 5 to 7 days, then when the cow feeds, they penetrate with the saliva and pass to the blood, appearing in the erythrocytes between 8 to 12 days. Symptoms of B [6]. bovis infections generally appear 2 to 3 weeks after tick infestation [7].
• Action: We saw the complexity of the mechanism of protozoan infection and of developing an early and highly sensitive diagnostic test. With the interview we were able to address the initial design of our test and select what would be the appropriate detection method.

Because of the low parasitaemia of hemotropic diseases, only a PCR gives you the appropriate sensitivity.

Ing. Jorge Cueva 

Specialist in Trypanosoma theileri detection

• Purpose: Design a prototype capable of recognizing biomarkers belonging to the genome of Babesia Bovis.
• Feedback: During interviews with experts it was mentioned that only third generation methods (those based on nucleic acid-based techniques) offer an for an accurate bovine babesiosis diagnosis.To implement synthetic biology in a diagnostic test, we decided to develop a biosensor capable of detecting two different and specific sequences of B.bobis. The design of our project was based on the Toehold switch technology and in order to increase the sensitivity of the test we contemplated including a previous isothermal amplification step.
• Action: We decided to opt for an isothermal amplification (RPA) to increase the specificity and sensitivity of the test.

The model depends very much on the parameters and the initial conditions, if the initial conditions are wrong, the model will give you any meaningless result.

Dra. Yadira Boada

PhD student at Universitat Politècnica de Valėncia

• Purpose:To obtain an estimated time of the proposed test we decided to model isothermal amplification (RPA) but we had difficulties in running the model in MATLAB. 
• Feedback: We contacted Dr. Yadira Boada who kindly offered to have a meeting with our team to solve some doubts regarding the modeling of the isothermal amplification. At the meeting she answered many of our concerns regarding the behavior of the chemical species involved in the proposed reactions as a function of time. He suggested that we modify the initial conditions of the model such as the concentration of recombinase and polymerase, and that we consider the primer as the limiting species in the reactions. 
• Action: After the virtual talk we were able to make corrections to the initial conditions and parameters, as well as the species involved in the reactions posed in the model. 

Diagnostic tests should be for the exclusive use of a professional, in order to avoid the indiscriminate use of medications.

Ing. Kelly Caiza

Specialist in the detection of Trypanosoma vivax

• Purpose: Evaluate the impact of a screening test for Babesia Bovis in Ecuadorian livestock.
• Feedback: Due to the difficult diagnosis of hemotropic diseases, cattle farmers abuse the number of antibiotics for vector control, which has repercussions on the quality of dairy and meat products destined for human consumption.
• Action: We developed a detection method for Babesia Bovis, which requires prior knowledge in diagnostic processes.

The costs of detection methods influence cattle farmers don't appeal to a Veterinarian.

Ing. Jefferson Jumbo 

Especialista en Tábanos 

• Purpose: Search for alternatives to reduce the costs incurred in the design of the prototype detection test for Babesia bovis.
• Feedback: The diagnosis of bovine babesiosis can be made directly by blood smear, necropsy or by the quantitative buffy coat technique and indirectly by ELISAi, molecularly by PCR or by loop-mediated isothermal amplification (LAMP). All these techniques have proven to be very satisfactory for the diagnosis of the parasite, both in the early and chronic stages of the disease. However, the use of molecular techniques is expensive, as in the case of PCR it costs $ 60 per test [8].
• Action: When the prototype is developed in the lab, we will seek to standardize the protocol of the Cell Free system in such a way that the number of test steps can be reduced and with them the costs of the reagents to be used.

State policies have not been directed towards turning Ecuador into a livestock and productive country with a view to exporting, which has not allowed us to fully develop as a world livestock power.

Ab. Enrique Baquerizo

Manager of the Litoral and Galapagos Cattle Raisers' Association

• Purpose: Analyze the impact of bovine health on the growth and development of the Ecuadorian cattle industry.
• Feedback: The development of the livestock industry is based on the continuous implementation of new technological tools, health protocols, disease control, research, and proper financial management.
• Action: We developed a business model where we integrate government agencies, private institutions, and iGEM Biotech EC as a startup that focuses on understanding the most basic needs of its target audience.

2.5. Impact on the Sustainable Development Goals (SDGs)

Our rapid screening test for Babesia bovis, is the first grain of sand, towards a style of animal husbandry in Ecuador, which seeks to strengthen the integration of animal welfare and health with the sustainable development of the cattle industry in Ecuador.

Figure 1. Objectives of The Sustainable Development Goals (SDGs).

Talks and interviews with experts

For the fulfillment of our objectives, we planned approaches with the people of interest, but previously we made an analysis of the situation with our mentor Dr. Armando Reina and the cattle breeder Biotechnologist Jimmy Jumbo, who knew how to guide us on the issues and forms of communication and interaction, which allowed us to establish our first contact through personalized interviews with different livestock associations in the country, laboratorians and experts in the hemotropics’ area. We focused on knowing, listening and understanding the real needs of the people, always addressing them with respect, trying to nourish ourselves with their knowledge acquired from generation to generation, which we used to learn from them and that they could learn from us, criteria that allowed us to identify the vulnerable points of why Ecuadorian livestock is in crisis, and today in Ecuador is not a profitable business.

One of the things that struck us most in the interviews is the fact that they were completely unaware of what their real enemy was (Babesia bovis, Anaplasma marginale and Trypanosoma vivax), phrases like "The tick killed the cow" were very frequent to hear. Not knowing what disease is attacking their cattle, they self-medicate their animals even though they know they are at risk of dying. These are issues that carry the Ecuadorian cattle industry to be in red figures due to the lack of disease control strategies in cattle.

Figure 2. Interviews with cattlemen and experts.

Informative talk: “Haemoparasitic diseases in the cattle”

So we planned an informative talk, which was designed and delivered by ourselves, as a way to initiate a connection with our audience of interest. We had the advice of experts such as our mentors Dr. Armando Reina, Dr. Maria Augusta Chavez and Dr. Claudia Segovia who supported us in the pedagogical area and review of the support material. We focused on ensuring that all the information gathered in the interviews was addressed and fed back. We wanted to provide all the access facilities, so we made a transmission by Facebook live by the Zoom platform, but we also took into account farmers who did not have internet access, for the latter case we made field visits to the communities of Paltas in the Loja province and Píllaro in the Tungurahua province, following all the biosecurity protocols.

In this way, we were fulfilling our first objective which is to educate a population that lacked knowledge about hemoparasitic diseases in Ecuador. 

Figure 3. Knowledge network and awareness raising of hemoparasitic bovine diseases.

Open discussion with experts: “In search of bovine health”

Our next activity was to evaluate the impact of our paper-based screening test for Babesia bovis on economic growth, decent work, increased production and responsible consumption. With this purpose, we organised an event where experts could discuss these topics. This event was called “In search of bovine health” which was transmitted by Facebook live by the Zoom platform . During our open discussion with experts in hemotropic diseases, we concluded that early detection allows economic development, since the veterinarian can provide immediate treatment and reduce diagnostic costs. In addition, the importance of bovine health was emphasized, since cattle production contributes to 7.7% of GDP, with a daily milk production at national level of 6.15 million liters, according to the National Institute of Statistics and Census of Ecuador - INEC (2020) [9]. On the other hand, it was suggested that the diagnosis should be integral, that is, it should start from the vectors, followed by the presence of the parasite, clinical signs and productive indicators. As a last point, it was mentioned that the adequate control and diagnosis of bovine diseases is a contribution to the regulation of the indiscriminate use of antibiotics, which affects the quality of dairy and meat products destined for human consumption. 

Figure 4. The objectives of The Sustainable Development Goals (SDGs)- Outreach

network in the open discussion.

Collaboration with the IXORA team, around the objective of responsible consumption and production

On October 1, 2021 the iGem Biotech EC team contacted via Discord with the IXORA team, with the aim of establishing active communication between teams (social networks and video calls) and develop ideas for collaboration that meet the needs of both parties. We coordinated a meet and greet meeting to socialize the projects under development, after which we served as a liaison between the expert in the area of heavy metal wastewater treatment, Eng. Luis Cumbal, for the IXORA team and their project related to water pollution. This allowed us to contextualize the project to a regional reality and to learn about other responses to the problem, available in the market (use of nanoparticles). The shared objectives addressed by the collaboration were in favor of responding to SDG 12, ensuring sustainable consumption and production patterns, given that water pollution affects the agricultural and livestock sector. In this case, cows drinking water containing Cadmium can bioaccumulate it and therefore meat consumption and human health is affected.

References

3.2 Collaborations

•  GENERAL MEETING "Meeting to present team's projects".

On Saturday, September 4th, 2021. Our team iGEM Biotech EC organized a general meeting with the teams participating in iGEM Design League. For this, we made a general invitation, of which we were pleased to participate: iGEM Biotech EC (host), SYNBIO IKIAM, IXORA, MIKUYTEC, and OLLIN SYNBIO. The objective of this meeting was to learn about the projects and problems that each team decided to focus on and how they propose to solve them. The meeting resulted in two major collaborations with the following teams: 

• SYNBIO IKIAM

On Monday, August 23, 2021 we held a meeting with the SYNBIO IKIAM team for a preliminary discussion on how our teams will collaborate with each other. With the meeting "Meeting to present team's ideas" we further strengthened the intention to collaborate between this team. After getting to know our projects in detail, a one-way collaboration was proposed for October 8, 2021 in which our team, iGEM Biotech EC, performed a review of the genetic circuit design belonging to the SYNBIO IKIAM team to help generate new perspectives of the design

Figure 1. Participation of SYNBIO IKIAM in the meeting "Meeting to present team's ideas" on September 4, 2021.

Figure 2. First meeting of iGEM Biotech EC with SYNBIO IKIAM on August 23, 2021.

• IXORA

We approached the IXORA team because we have a strong relationship on a Sustainable Development Goal. The third SDG "Health and Wellness" indicates the need to ensure quality in food. The IXORA team promotes the remediation of water contaminated by cadmium while iGEM Biotech's objective, in terms of this SDG, is to ensure the quality of beef cattle meat. Therefore, a meeting was organized to learn how each team approaches the solution to their problems, which resulted in a researcher from Ecuador, Dr. Luis Cumbal, who is a specialist in cadmium remediation in soils. Therefore, on Monday, October 18, 2021, we held a meeting so that the IXORA team could solve specific doubts about the remediation of this metal in water.

Figure 3. IXORA's participation in the meeting "Meeting to present team's ideas" on September 4, 2021

The first meeting between the IXORA team and iGEM BIOTECH EC was held on October 4, 2021 to organize the collaboration. On October 18, 2021 the one-way collaboration was given by a researcher close to iGEM BIOTECH EC who was able to advise the IXORA team on the work they are doing.

Figure 4.  First meeting of iGEM Biotech EC with IXORA on October 4, 2021.

• IXORA - “Behind the Scenes of iGEM” Art and Creativity

Teamwork has no limits, and its final product is rewarding.

Cristina Pilamunga

iGEM Biotech EC Student Member

In iGEM Biotech EC we crossed all barriers looking for ways to collaborate with other iGEM teams and met the IXORA team (Colombia). We met on October 4 and 10, 2021 to organize publications in social networks with the theme "Behind the Scenes of iGEM", aiming to convey what it means to be an iGEMer in a creative and informal way. Seeking to encourage our followers to love science, because despite being a strong path it is beautiful to enjoy it.

Figure 6. Collaboration: “Behind the Scenes of iGEM” between iGEM BIOTECH EC and IXORA team. See all our posts in the links here: iGEM Biotech EC and IXORA.

• IXORA - Modeling

On October 20, 2021, the IXORA team collaborated in a modeling meeting. Members and Instructors of this team, advised on how to use different programs for RNA 3D modeling. There was also a revision of the RPA amplification to simplify the model. On the other hand, Francisco Flores, mentor of the iGEM BIOTECH EC team, conducted a review on the promoters who were using this equipment.

Figure 7. Collaboration in modeling between iGEM BIOTECH EC and IXORA team.

• iGEM LATAM Fest - Art and Creativity

Since the week of September 6, 2021, the team of iGEM Ecuador, IKIAM and iGEM Biotech EC began to meet to collaborate and work together on the project and video iGEM Latin Cinema. Several activities were developed, being in charge of the iGEM Biotech EC team recordings and cultural contributions by Nathaly Romero and Maria del Carmen Mendoza, in addition to the video editing by Cristina Pilamunga. The Latin film festival had different themes, being an activity where not only science was shared. In the case of Ecuador had the opportunity to present the colloquial words of our beautiful country, with the aim of showing small brushstrokes of diversity and multiculturalism in Latin America.

Figure 8. Collaboration in iGEM LATAM Fest “iGEM Latin Cinema”.

• iGEM Ecuador - Modeling

Since the creation of the iGEM Biotech EC there has been constant communication between the two teams. At the beginning, some team members gave their opinion at the time of setting up the iGEM Biotech EC project, providing guidance on the feasibility of the proposed ideas and their criteria according to their experience. In addition, there was an external collaboration in the creation of a video with the theme "The Ecuadorian Dictionary", made by all iGEM teams in Ecuador, including the synbio IKIAM team, to be presented at the iGEM Latin Fest. There were also sporadic consultations on various topics related to the competition, such as the safety of the project if it were to be implemented, specific meetings have been set up to consult on the mathematical modeling of the design proposed by the Design League team, in addition to their guidance on how to establish the standardization and optimization criteria for the iGEM Biotech EC design.

Figure 9. Collaboration in modeling between iGEM Ecuador and iGEM BIOTECH EC team.



3.3 Entrepreneurship and Innovation

Our perfect business world

Every problem is born from a need, every idea from wanting to satisfy it. For the design of our business model, we were inspired by the circular flow of income, which we reformed by integrating Human Practices, design, modeling, our project development and the world around us. In order to make a continuous feedback between these areas to identify the strengths and weaknesses of our product. And as a team we look for new alternatives that allow us to improve and innovate day by day the product we offer to our potential market. All in an environment that adapts to the standards and policies of our country already established.

Figure 1. Integrated business model- iGEM Biotech EC.

3.4 Educational and science communication

• Student talk

Through a talk we highlighted the key points to understand what synthetic biology is, starting from the central dogma of molecular biology. Our talk was aimed at students who had little knowledge of biology, so it was decided to use audiovisual material, which contained the basic concepts. In collaboration with the Arts and Creativity Committee, we created illustrations that helped us portray the theory, even for people who are not involved in biological sciences in the activity “ Teaching Science with Art”. In this way they were able to see directly the results of all the applications of synthetic biology starting from its foundations. 

In a conversation open to questions, SynBio advances such as biosensors, biofactories and projects carried out in recent years, which made use of synthetic biology to provide a solution to a specific problem, were explained. At the end of the talk we talked about what iGEM is and how we were participating in it. In order to demonstrate that the objective of having the students retain the knowledge imparted and make use of it was achieved, we proposed 2 activities to be carried out. The first one is called “External Perspectives on Synthetic Biology”, were they all placed 2 words that demonstrate what synthetic biology is for them, where for most of them they related it to "Design", and another in which they had to make a drawing in which they represented what they understood by synthetic biology, for this we showed them examples that were formed by drawings made by the iGEM Biotech EC team, where we explained what synthetic biology means for us. 

Finally, with the help of all our material, we had a conversation between speakers and students where all the concerns of the subject were answered, and thus encourage students to go deeper into this area, and that in the future they themselves design their own projects.

Figure 2. “External Perspectives on Synthetic Biology” Representation of the meaning of synthetic biology for students.

• Tutorial Video

The motivation to elaborate a video tutorial arises from the need we had during the modeling process of our project, in the handling of the NUPACK program, we think that providing a guide with punctual and applied information of this tool is essential, so that the students have the facility to develop their research projects. In the video tutorial we focus on aspects such as, A correct use of the elements for the development of the script, with the objective that there are no errors in the compilation of the program. Exemplify in a clear way how to obtain a correct model according to the objective of the project, in this practical case a toehold with the appropriate triggers sequences. In addition, we show the respective analysis of the study sequences together with graphs that facilitate a better understanding of the subject. We knew in advance who would be our audience, so the video was developed a little more technical and concise in what we wanted to explain (watch video).

• Conversation

Our open discussion "In Search of Bovine Health" took place on Friday, October 15, 2021, through the Zoom platform and was transmitted via Facebook live so that anyone interested in the subject or in learning something new could have access to. It was attended by experts in hemotropic, cattle and bovine health, who gave answers to certain questions established by our team in order to know the impact that our Babesia bovis detection test would have on society. It was a very informative and enriching space for us as well as for the people who were there live, and the content of the discussion allowed us as a team to give the focus we needed to our screening test, in addition to knowing the scope it would have in Human Practices. The importance was emphasized of giving the necessary attention to this type of problems in livestock farming by the government, public and private entities highlighted, who due to lack of knowledge of all the economic losses caused by this type of diseases, do not give them the importance they require. As a final part of this event, the young people were encouraged to investigate a little more about science and synthetic biology and how it can provide solutions to the problems we face as a society and as a country (watch video).

• Livestock talk

The event took place at the beginning of October and was entitled 'Hemoparasites in Ecuador'. The content and modality of the event focused on presenting in a simple and didactic way all the scientific concepts that encompass hemoparasites (life cycle, infection mechanisms, diagnostic methods and detection methods). The slides of the presentation were designed highlighting the visual, avoiding the use of long and boring texts that were replaced by interactive images, illustrative colors and a common language that helped the viewer to understand the harmful presence of hemoparasites in Ecuador and the importance of the search for better detection methods to ensure bovine health and the economic welfare of thousands of Ecuadorian families dedicated to this trade. 

The attendees to the event were always involved and extremely interested in the importance of hemoparasites in the country, in the specialists dedicated to their study and the invaluable applications that can be achieved through the use of Synthetic Biology. In iGEM Biotech EC we are aware of the lack of resources to inform the public about these topics. Therefore, all the informative material of the event was stored and uploaded on our Facebook page. Thus, the material is available to anyone interested in the subject allowing a more enriched dialogue with verified and current information that allows a democratization of knowledge achieving a more informed and fairer society. 

Figure 3. Didactic Material of the livestock talks “Hemoparasites in Ecuador”.

3.5 Policy, biosafety and/or biosecurity

• Biosafety and biosecurity

During the Design League competition we do not plan to conduct laboratory experiments, as we only focus on the design stage that we have performed with telematics and bioinformatics tools. The parts we use in our design do not pose any significant problems or risks, as long as the Biosafety Standards for a Level-1 Laboratory are followed to the strictest extent [1]. Our design is made up of a set of Pre-existing parts of iGEM (see Biological Parts Section), the main part is the construct formed by the toehold switch designed by us. No complete organism is used as a chassis, because it is a cell free system, but a cell extract is required as a medium that contains several components necessary for the detection reaction, in this case the E. coli BL21 (DE3) strain, these organisms do not cause serious diseases in humans, do not represent a risk for researchers, nor the public, nor the environment, since they are classified within risk group 1 (BSL 1) [2]. 

On the other hand, the coding sequences for the HrpS (BBa_K1014000) and HrpR (BBa_K1014001) proteins, which are necessary to activate the HrpL promoter (BBa_K1014002), are part of the design; the genes of these parts originate from the gram-negative bacterium Pseudomonas syringae. The genus Pseudomonas is in risk group 2 (BSL 2) [2], however, Pseudomonas syringae is a plant pathogen that can infect a wide range of plant species, but not humans, so it does not represent a risk to the researcher, in addition to the fact that the whole organism is not used, but only the coding sequences to the proteins mentioned. 

Thus, we comply with the standards according to the iGEM white list [3] regarding all the sources of origin of the parts used for the design. We have raised laboratory protocols to develop the screening test in the future, in that case it is planned to follow the Biosafety Standards for a Level-1 Laboratory, and all members who would eventually perform the experiments, have been trained about basic biosafety standards and have received laboratory practice with teachers in university classes. In addition, no risks to the public or the environment have been established, taking into account that proper waste management and waste handling regulations must be followed, commensurate with the biosafety level of the laboratory. 

• Policy

iGEM Biotech Ec is constituted by two universities: ESPE and Yachay Tech. Therefore, the Research Ethics Committee of the Experimental Technology Research University Yachay Tech has been consulted. This committee is directed by several professors and external observers who evaluate the research from an ethical perspective in order to encourage and ensure compliance with good research and experimentation practices. Taking into account the objectives of our project as well as the construction of the constructs. Our project has been determined under the observations of the Agency of Regulation and Phytosanitary and Zoosanitary Control of Ecuador (AGROCALIDAD) as well as the World Organization for Animal Health (OIE), as it regulates veterinary products such as diagnostic kits. 

In one of the talks with experts, the Biotechnology Engineer Kelly Caiza mentioned as an observation, that in case the test goes on sale, it should be performed by trained personnel, for example veterinarians, who after diagnosing the disease, can prescribe the appropriate medicine to treat the disease, because otherwise there is a risk of generating resistance of the microorganism and increase the severity of outbreaks. 

In Ecuador, the Constitution of the Republic of Ecuador is the highest law governing the use of GMOs in the national territory. Article 401 states that 'Ecuador is a country free of transgenic products'[4]. However, there are numerous other legal instructions governing the use, distribution, purchase and sale of inputs for veterinary products [5][6][7]. Thus, AGROCALIDAD regulates through the General Laboratory Coordination the determination of tests applicable to animals handling biological agents of potential risk to veterinary public health and establishes the parameters and procedures that biological drugs for veterinary use must comply with so that the product can be used without presenting any risk to both animals and humans [8]. All these procedures are detailed in depth in the ''Instructions for certification audits of good manufacturing and storage practices for veterinary products'' attached in the references. 

Rerefences

3.7 Arts and creativity activities and results

Synthetic Biology is characterized by the integration of several areas of knowledge allowing to bring together science, engineering and humanities in the same project. Based on this premise, we have carried out different activities that have allowed us to know how synthetic biology is perceived using didactic tools that allow us to explore the ideas of the public and those of our own colleagues. We worked together with the Education Committee structuring activities such as: "External Perspectives on Synthetic Biology" and "Teaching Science with Art".

Figure 1. To tell you about all these experiences we created a didactic album called “iGEM Biotech EC: Arts and Creativity Album”. To show you with images, all of our labour.

We worked together with the Education Committee structuring activities such as: "External Perspectives on Synthetic Biology" and "Teaching Science with Art".

Some rules are to be broken, such as the belief that art and science are necessarily two incompatible branches.

Sofía Garrido

iGEM Biotech EC Student Member

Art through creativity and creation is a tool that by merging with science, breaks the gap between academia and the community, facilitating scientific divulgation and therefore directly influencing the management of public policies related to scientific inventions. In iGEM Biotech EC we believe that art is a form of teaching and divulgation. Through our first activity ( "External Perspectives on Synthetic Biology”) we obtained first hand, the public's perception of Synthetic Biology without previous knowledge of it and basic knowledge of biology. We found that there is great acceptance of this branch of science as they perceive it as innovative and linked to a complex design. 

In our second activity ("Teaching Science with Art") we aimed to introduce the fundamental concepts of synthetic biology by representing them in an entertaining, familiar and easy-to-remember way. Concepts such as DNA as the molecule that provides the characteristics to living organisms, the concept of biofactories and design in synthetic biology.

Figure 2. “Teaching Science with Art”: Illustrations made by the Arts and Creativity Committee representing the basic concepts of Synthetic Biology and their brief description.

The aim of this activity was to help our audience create their own illustrations of their interpretation of what Synthetic Biology is for them. By linking some common words and easy-to-interpret images to new technical concepts, they were able to understand the more complex ideas of our presentation. This facilitated their learning process and most importantly, creating their own interpretations. Our audience created drawings with complete freedom of expression and representation of their ideas. They came up with new ways This facilitated their learning process and most importantly, creating their own interpretations. They came up with new ways of representing Synbio. The most common symbols were DNA, cells and lab tools. 

We were no slouches either! Our iGEM Biotech team also created our own illustrations explaining what this integrative science means to us.

Figure 3. Illustrations of our listeners and the iGEM Biotech EC team, representing what Synthetic Biology means for them. (See all of their works of art in our iGEM Biotech EC: Arts and Creativity Album Linked in Documents Section)

In addition, we encouraged the integration of several iGEMers teams and shared our experiences during the competition with the collaboration of IXORA and sharing a bit of Ecuadorian culture with the iGEM community through video presentations.

• Designed Biological Parts, in FASTA, GENBANK: Designed Biological Parts_iGEM Biotech EC and Results_design_ SBOLDesigner
• Safety Form Questions and Answers: Safety Form_iGEM Biotech EC
• Project Supporting information: 

1_Parameters_Toeholdswitch_design 

2_Results_Individual toehold switch_design 

3_Results_ inhibitory hairpin_design and design script

4_Results_internal control_design

5_tables_design_iGEM Biotech EC

6_RPA_Primers_design and Analysis

7_model script_MATLAB

8_protocols_iGEM Biotech EC

Didactic Material of the livestock talks “Hemoparasites in Ecuador”

iGEM Biotech EC: Arts and Creativity Album